Unit 2 / 11

DNA/RNA Sequence Analysis: Alignment, Motif, Open Reading Frame and Basic Bioinformatics

Gains:

  • Understand the concepts of sequence alignment, motif searching and open reading frame (ORF) and have the artificial intelligence produce executable, verifiable Biopython/analysis code.
  • Ability to check frame, strand and genome version assumptions in the sequence and code produced by artificial intelligence and compare the result with a known reference
  • Ability to apply the discipline of not using any sequences given by artificial intelligence from the head and confirming each sequence from a primary source such as NCBI / Ensembl

Sequence analysis is the most fundamental task of molecular biology: reading a DNA strand (or U in RNA) consisting of the letters A, T, G, C, comparing it, and finding meaningful regions (genes, motifs, regulatory sequences) within it. In this unit, you will learn how to use artificial intelligence (AI) as a code writing and interpreting partner in these works; but you will learn why you should always verify the result with executable code and primary source. Our core toolset will be Biopython (a Python library written for working with biological sequences) and official alignment tools.

First a warning: LLM can produce errors from memory, even a short sequence. It can mix up a letter when asked to calculate the reverse complement of a sequence head-on. Therefore, never perform string operations by relying on the AI's text response, but with the code that the AI ​​writes and you run.

Basic concepts: what do we work with?

  • Base pair (bp): The letter unit of DNA. The human genome is approximately 3.2 billion bp.
  • Strand: DNA is a double helix; The two strands are the anticomplement of each other. It matters in which thread a variant is declared.
  • Codon: Group of three bases; each codon corresponds to an amino acid (the building block of protein). For example, ATG is usually the start codon (methionine).
  • Open reading frame (ORF): The sequence region that can code for a protein, extending from the start codon to the stop codon (TAA, TAG, TGA).
  • Motif: Repeating short sequence pattern that has a specific function; for example, the region to which a transcription factor binds.
  • Alignment: Arranging two or more sequences one under the other to see their similarities.

Step by step: sequence analysis workflow

1. Get the series from reliable source. Don't make the AI ​​say "remind" the sequence; Download it as FASTA (standard text format that stores sequences) from a source such as NCBI, Ensembl, etc. and give this sequence to the AI.

2. Have the transaction done with code. Have operations such as reverse complement, transcription (DNA→RNA), translation (RNA→protein), GC ratio done by Biopython code and run the code yourself.

3. Check framework and thread assumptions. Ask him/her to clearly state in the comment line which thread and in which reading frame the code is running.

4. Compare the result with the known reference. Match the protein or ORF you produced with the known record in the database. Length and initial mismatch capture the most common errors.

5. Confirm alignment with official tool. Don't let the AI ​​"eyeball" the similarity of two series; Get a numerical score with BLAST (sequence similarity search tool) or an alignment library.

Tip: Always let string length be your first check. The number of amino acids of a protein is approximately one-third of the number of bases of the coding sequence (excluding the stop codon). If the length doesn't fit, the frame or thread is wrong.

three mini cases

Case 1 — Inverse complement error. A student asked AI about the reverse complement of the sequence 5'-GATTACA-3'; The AI ​​gave "TGTAATC" (correct). However, in a longer sequence of 20 bases, the AI ​​skipped a base and the result was 19 bases. When the student ran it with Seq("...").reverse_complement() in Biopython, it took 20 bases and caught the error. Time lost: 2 minutes.

Case 2 — Frame shift. A researcher had a 900-base coding sequence translated into protein; The AI ​​"read" a 280 amino acid protein by text. The expected was 299 amino acids (900/3 − 1 stop). The difference was that the AI ​​started from the second nucleotide. The correct length was obtained when the code was started from the first frame.

Case 3 — Confirmation gained. A laboratory technician examined the 16S rRNA sequences of two bacterial strains by asking "are they the same?" he asked the AI; "Most likely the same," the AI ​​said. When the technician ran BLAST, he saw 97.8% similarity and 12 base differences — a critical difference for species-level discrimination. If there was no numerical score, the wrong "same" result would be entered in the report.

Example: a verifiable Biopython stream

from Bio.Seq import Seq# Import the sequence from the FASTA you downloaded from NCBI; Don't make the AI say "remind me". dna = Seq("ATGGCCATTGTAATGGGCCGCTGAAAGGGTGCCCGATAG")print("Length (bp):", len(dna))print("GC rate (%):", round(100 * (dna.count("G") + dna.count("C")) / len(dna), 1))print("Reverse complement:", dna.reverse_complement())# Translation from frame 1; up to stop codonprotein = dna.translate(to_stop=True)print("Protein:", protein, "| Length (mm):", len(protein))

Even though the AI ​​writes this code, you see the accuracy of the output by running it. Length, GC ratio, and protein are comparable to the known reference.

Four copyable templates

1) Verifiable array operation:

Write an executable Biopython code for the following FASTA sequence: [sequence/task]. Calculate the length, GC ratio, reverse complement, and translation from frame 1. Comment out which thread and frame are assumed. Do not produce the sequence; Just use the sequence I gave you.

2) ORF screening:

Write a Python code that finds all open reading frames in the given sequence (and all three on the optional reverse strand). Report the start position, length, and translated protein for each ORF. Also mark the longest ORF.

3) Alignment confirmation:

I want to compare two arrays. "Similar?" Don't judge by eye; write a pairwise alignment code and report the similarity percentage and difference number numerically. Source: [series 1], [series 2].

4) Motif search:

Search for the following motif (also as a regular expression) in the given string: [motif]. List the location (1-based) of all matches. Write and specify overlapping matches as well.

Weak prompt / Strong prompt

Weak: "Write the protein of this sequence: ATGGCC..."

Problem: AI translates with text, may confuse frame/thread, can't verify length.

Strong: "Write an executable Biopython code that translates the following sequence from frame 1, reports the length and stop codon; do not change the sequence, just use the one I gave: ATGGCC..."

Why it's powerful: Processing is done in code, framework is clear, output can be verified numerically.

Quest

wrong approach

right approach

reverse complement

Let AI write with text

Biopython reverse_complement()

translation

Let AI translate from memory

Code, specifying the framework

similarity

"Similar?" eye decision

BLAST/alignment score

motif

Let the AI count by hand

Code, with location list

Array source

Let AI remember

FASTA from NCBI/Ensembl

Common mistakes

  • Not specifying the framework. Translation from the wrong frame yields a short or faulty protein.
  • Tangling the yarn. The variant or motif may be in reverse thread; thread assumption should be written.
  • Making the AI ​​memorize the sequence. LLM cannot produce long string without errors; You always provide the series.
  • Judging by eye for similarity. Don't say "same/similar" without a numerical score.
  • RNA/DNA mixture. Mixing U with T disrupts translation; clarify the input type.
Caution: Even a high percentage similarity in BLAST and similar tools does not necessarily mean biologically "identical"; The e-value (chance probability) and the length of the aligned region should be evaluated together.

Depth: reading a BLAST output correctly

Having AI interpret a BLAST result saves time; But don't make any decisions until you read the three issues yourself. The first is the e-value (expected value): the expected number of times this score can occur by chance; A very small value like 1e-50 means strong, a value like 0.1 is almost noise. The second is query coverage: what percentage of the query sequence the match covers; 98% similarity but only 20% coverage means that a small part of the sequence is similar and is misleading. The third is percent identity. Without these three read together, a high percentage alone does not prove anything.

A concrete example: a researcher BLASTed a fragment of a gene he had just sequenced; “99% match to human BRCA2, same gene,” the AI ​​said. When the researcher looked at the output, he saw that the coverage was only 15% — the matching part was just a short, repeat region out of thousands of bases of BRCA2. The correct interpretation was not "same gene" but "shares a common repeat motif". Reading the scope prevented a complete misidentification.

BLAST column

what does it say

trap

E-value

probability of coincidence

If it is high, the match may be meaningless

Query coverage

Covered query rate

If it is low, the percentage is misleading

percent identity

Matching base rate

alone is not enough

bitscore

Normalized alignment strength

Interpreted according to length

5) BLAST output interpretation template:

Interpret the following BLAST table, but don't decide: summarize the e-value, query coverage and percent identity for each row separately and indicate what thresholds need to be met before reaching a conclusion like "same gene". Table: [paste].

In summary

  • Sequence operations (reverse complement, translation, ORF, GC ratio) should be done with the code that the AI writes and you run, not with the AI's text response.
  • Framework and thread assumptions should always be explicitly stated; length check is the fastest error catching tool.
  • Always get the sequence from reliable source (NCBI, Ensembl); Don't make AI memorize it.
  • Similarity and alignment are evaluated by official tools and numerical scores, not by eye.

Application task

Download a short coding sequence from a reliable source (e.g. NCBI). With templates 1 and 2 above, ask the AI ​​for a Biopython code, run the code; Compare the length and sequence of the protein you produced with the known record in the database. If you find a mismatch, try to fix it by changing the framework/thread assumption and note the process.

checklist

  • [ ] I got the sequence from a reliable source, I didn't have the AI memorize it.
  • [ ] I performed array operations with executable code.
  • [ ] I have clearly specified the framework and thread assumption.
  • [ ] I compared the protein/ORF length with the reference.
  • [ ] I evaluated the similarity with the official tool and numerical score.
  • [ ] I checked RNA/DNA and U/T separation.